Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES
This kit is the special kit for high-throughput DNA library preparation for MGI. Set 1 contains 16 kinds of barcode(adapter 57-72); Set 2 contains 96 kinds of barcode. All the reagents provided in the kit are subjected strict quality control and functional verification to ensure the maximum stability and repeatability of the library preparation. Specifications Cat.No. 13361ES02 / 13361ES04 13362ES02 / 13362ES04 Size 16×2 T / 16×4 T 96×2 T / 96×4 T Components Cat. No. Name 2 T 4 T 13361 16 barcode 10 μL each 20 μL each 13362 96 barcode 10 μL each 20 μL each Shipping and Storage This product should be stored at -25~-15℃ for 2 years. Note 1. The concentration of DNA adapters in these kits is 10 μM 2. Do not heat the adapters. They should be dissolved slowly at room temperature. It is best to set the laboratory temperature at 20-25℃. Avoid repeated freezing and thawing of the adapters. It is recommended to store them in separate packs. The adapters can be stored at 4℃ for a short time. 3. There are 96 barcodes at most for MGI adapters. When 96 barcodeproducts are used for library preparation and sequencing, the selection of barcodes shall be operated according to the combination recommended by MGI. See the use method for specific specifications. 4. For your safety and health, please wear experimental clothes and disposable gloves. 5. For research use only. 6. This adapter is not compatible with PCR-free library preparation protocols and must be used with amplification primers (Cat# 12191ES) for library construction. Instructions Sequence The structure of libraries prepared with Hieff NGS TM Complete Adapter Kit for MGI are as follows: 5’ - Bottom Adapter - Insert DNA Sequence - Barcode Adapter- 3’ DNA Adapter: Barcode Adapter: 5’-phos AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAXXXXXXXXXXCAACTCCTTGGCTCACA-3’ Bottom Adapter:5’-TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT-3’ Before sequencing, just enter the barcode sequence (10 bp) in the sample sheet. barcodecombination rules: Documents: Safety Data Sheet 13361_MSDS_HB250522_EN.PDF Manual 13361_Manual_HB20260602
Specifications
- Size
- 16×2 T, 16×4 T
Variants (2)
- 16×2 T — 135.00 USD — In stock
- 16×4 T — 235.00 USD — In stock
AI Readiness
Good foundation, but some important product data is still missing.